| Detail of EST/Unigene DY329371 |
| Acc. | DY329371 |
| Internal Acc. | OB_MEa0004B16.r |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 1-deoxy-D-xylulose-5-phosphate synthase, chloroplastic OS=Arabidopsis thaliana E-value=1e-09; Probable 1-deoxy-D-xylulose-5-phosphate synthase, chloroplastic OS=Capsicum annuum E-value=1e-08; 1-deoxy-D-xylulose-5-phosphate synthase 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-08; Probable 1-deoxy-D-xylulose-5-phosphate synthase 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-08; |
| Length | 343 nt |
| Species | Ocimum basilicum |
| Belonged EST Libraries | OB_MEa; |
| Sequence | TGGCGGCCGATGGTACTCCCAGATAGGTACATTGATCATGGAGCACACCCAGATCAGATA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827230 |
| Trichome-related Gene from Literature | 827230 |