Detail of EST/Unigene DY329849 |
Acc. | DY329849 |
Internal Acc. | OB_MEa0004L21.f |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Trans-cinnamate 4-monooxygenase OS=Glycine max E-value=1e-47; Trans-cinnamate 4-monooxygenase OS=Glycyrrhiza echinata E-value=1e-47; Trans-cinnamate 4-monooxygenase OS=Vigna radiata var. radiata E-value=5e-47; Trans-cinnamate 4-monooxygenase OS=Populus kitakamiensis E-value=5e-47; Trans-cinnamate 4-monooxygenase OS=Catharanthus roseus E-value=1e-46; |
Length | 411 nt |
Species | Ocimum basilicum |
Belonged EST Libraries | OB_MEa; |
Sequence | TGTTACACTCTGCTTGCCAAGAACCGCTGAGATTTCGTCACGGATTTTCTGCTGGATGGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1 |
EC | 1.14.14.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817599 |
Trichome-related Gene from Literature | 817599 |