Detail of EST/Unigene DY330012 |
Acc. | DY330012 |
Internal Acc. | OB_MEa0004P07.f |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 4-coumarate--CoA ligase 1 OS=Nicotiana tabacum E-value=0; 4-coumarate--CoA ligase 2 OS=Nicotiana tabacum E-value=0; 4-coumarate--CoA ligase 1 OS=Solanum tuberosum E-value=0; 4-coumarate--CoA ligase OS=Vanilla planifolia E-value=0; 4-coumarate--CoA ligase 2 OS=Solanum tuberosum E-value=0; |
Length | 867 nt |
Species | Ocimum basilicum |
Belonged EST Libraries | OB_MEa; |
Sequence | GAAAAAAATATGAAATATTATTGCAGGCACTTTTCTTAATTAGGCTTCATATAATTGCAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00650 Butanoate metabolism > K01896 medium-chain acyl-CoA synthetase; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K01897 long-chain acyl-CoA synthetase; Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K01904 4-coumarate--CoA ligase |
EC | 6.2.1.12 6.2.1.3 |
Transcription Factor Family | |
Transporter Classification Family | 2.A.1 Major facilitator superfamily MFS |
Probeset |
|
Corresponding NCBI Gene | 841593 |
Trichome-related Gene from Literature | 841593 |