Detail of EST/Unigene DY335465 |
Acc. | DY335465 |
Internal Acc. | OB_SEa02I11.r |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Hydroxymethylglutaryl-CoA synthase OS=Arabidopsis thaliana E-value=9e-68; Hydroxymethylglutaryl-CoA synthase 1 OS=Blattella germanica E-value=2e-27; Hydroxymethylglutaryl-CoA synthase A OS=Dictyostelium discoideum E-value=9e-26; Hydroxymethylglutaryl-CoA synthase, mitochondrial OS=Rattus norvegicus E-value=4e-25; Hydroxymethylglutaryl-CoA synthase, mitochondrial OS=Sus scrofa E-value=7e-25; |
Length | 768 nt |
Species | Ocimum basilicum |
Belonged EST Libraries | OB_SEa; |
Sequence | GGGGCTAAATTGAATTTCATTTCCTCTTTAAGGAGAATAGAATTACACCCATCTACAGGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00650 Butanoate metabolism > K01641 hydroxymethylglutaryl-CoA synthase; Metabolism > Lipid Metabolism > ko00072 Synthesis and degradation of ketone bodies > K01641 hydroxymethylglutaryl-CoA synthase; Metabolism > Amino Acid Metabolism > ko00280 Valine, leucine and isoleucine degradation > K01641 hydroxymethylglutaryl-CoA synthase |
EC | 2.3.3.10 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 826788 |
Trichome-related Gene from Literature | 826788 |