| Detail of EST/Unigene DY339353 |
| Acc. | DY339353 |
| Internal Acc. | OB_SEa09P21.f |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Aldehyde dehydrogenase family 2 member C4 OS=Arabidopsis thaliana E-value=6e-29; Aldehyde dehydrogenase family 2 member B4, mitochondrial OS=Arabidopsis thaliana E-value=2e-24; Aldehyde dehydrogenase family 2 member B7, mitochondrial OS=Arabidopsis thaliana E-value=3e-22; Aldehyde dehydrogenase, mitochondrial OS=Pongo abelii E-value=1e-17; Aldehyde dehydrogenase, mitochondrial OS=Sus scrofa E-value=1e-17; |
| Length | 338 nt |
| Species | Ocimum basilicum |
| Belonged EST Libraries | OB_SEa; |
| Sequence | CAGAGCAGGTGATTGTGAATGTTGCTGAAGGCGATAAGGAAGATGGTGATTTGGTCGTCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00903 Limonene and pinene degradation > K00128 aldehyde dehydrogenase (NAD+); Metabolism > Xenobiotics Biodegradation and Metabolism > ko00631 1,2-Dichloroethane degradation > K00128 aldehyde dehydrogenase (NAD+); Metabolism > Xenobiotics Biodegradation and Metabolism > ko00641 3-Chloroacrylic acid degradation > K00128 aldehyde dehydrogenase (NAD+); Metabolism > Carbohydrate Metabolism > ko00053 Ascorbate and aldarate metabolism > K00128 aldehyde dehydrogenase (NAD+); Metabolism > Carbohydrate Metabolism > ko00650 Butanoate metabolism > K00128 aldehyde dehydrogenase (NAD+); Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00128 aldehyde dehydrogenase (NAD+); Metabolism > Carbohydrate Metabolism > ko00640 Propanoate metabolism > K00128 aldehyde dehydrogenase (NAD+); Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K00128 aldehyde dehydrogenase (NAD+); Metabolism > Lipid Metab |
| EC | 1.2.1.3 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 822042 |
| Trichome-related Gene from Literature | 822042 |