Detail of EST/Unigene DY632448 |
Acc. | DY632448 |
Internal Acc. | Medicago--01-C15.g1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein P4, chloroplastic OS=Pisum sativum E-value=2e-20; Chlorophyll a-b binding protein 4, chloroplastic OS=Arabidopsis thaliana E-value=2e-18; Chlorophyll a-b binding protein 1B-20, chloroplastic (Fragment) OS=Hordeum vulgare Ib-20 E-value=1e-17; Chlorophyll a-b binding protein CP26, chloroplastic OS=Arabidopsis thaliana E-value=1e-08; Chlorophyll a-b binding protein CP29.1, chloroplastic OS=Arabidopsis thaliana E-value=1e-08; |
Length | 315 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_UV-B; |
Sequence | TTCGAGCGGCCGCCCGGGCAGGTAGGAAATTGCTAATGGGAGATTGGCAATGTTGGCATT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 823901 |
Trichome-related Gene from Literature | N/A |