| Detail of EST/Unigene DY632568 |
| Acc. | DY632568 |
| Internal Acc. | Medicago--01-O23.g1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 1A, chloroplastic OS=Pyrus pyrifolia E-value=1e-13; Chlorophyll a-b binding protein type 2 member 1A, chloroplastic OS=Pinus sylvestris E-value=1e-13; Chlorophyll a-b binding protein M9, chloroplastic OS=Zea mays E-value=1e-13; Chlorophyll a-b binding protein 3, chloroplastic OS=Glycine max E-value=1e-13; Chlorophyll a-b binding protein type 1 member F3, chloroplastic OS=Polystichum munitum E-value=1e-13; |
| Length | 110 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_UV-B; |
| Sequence | CCGAGGTCGGATGGGACACTGCTGGACTTTCTGCTGACCCAGAGACATTCGCCAAGAACC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 822391 |
| Trichome-related Gene from Literature | N/A |