Detail of EST/Unigene DY632673 |
Acc. | DY632673 |
Internal Acc. | Medicago--01-J11.g1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein C, chloroplastic OS=Nicotiana plumbaginifolia E-value=2e-43; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=3e-43; Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=3e-43; Chlorophyll a-b binding protein E, chloroplastic OS=Nicotiana plumbaginifolia E-value=6e-43; Chlorophyll a-b binding protein 16, chloroplastic OS=Nicotiana tabacum E-value=6e-43; |
Length | 415 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_UV-B; |
Sequence | TAGCGTGGTCGCGGCCGAGGTACAAACTTAGGGGAAAAAAAGATGTAACATGCCATGCGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839871 |
Trichome-related Gene from Literature | 839871 |