Detail of EST/Unigene DY632675 |
Acc. | DY632675 |
Internal Acc. | Medicago--01-K08.g1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Putative calcium-transporting ATPase 11, plasma membrane-type OS=Arabidopsis thaliana E-value=1e-18; Calcium-transporting ATPase 4, plasma membrane-type OS=Arabidopsis thaliana E-value=2e-17; Calcium-transporting ATPase 2, plasma membrane-type OS=Arabidopsis thaliana E-value=8e-13; Calcium-transporting ATPase 3, plasma membrane-type OS=Oryza sativa subsp. japonica E-value=1e-12; Probable calcium-transporting ATPase 4, plasma membrane-type OS=Oryza sativa subsp. japonica E-value=4e-12; |
Length | 211 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_UV-B; |
Sequence | GCGGCCGCCCGGGCAGGTACAGCAGTTGAATCTGGGCCACTTAGTCCCAGCAGCCTCTTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | 3.A.3 P-type ATPase superfamily P-ATPase |
Probeset |
|
Corresponding NCBI Gene | 824900 |
Trichome-related Gene from Literature | N/A |