| Detail of EST/Unigene DY632676 |
| Acc. | DY632676 |
| Internal Acc. | Medicago--01-K09.g1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S3, chloroplastic OS=Lotus japonicus E-value=7e-26; 30S ribosomal protein S3, chloroplastic OS=Ipomoea purpurea E-value=1e-24; 30S ribosomal protein S3, chloroplastic OS=Nicotiana tabacum E-value=1e-24; 30S ribosomal protein S3, chloroplastic OS=Nicotiana tomentosiformis E-value=1e-24; 30S ribosomal protein S3, chloroplastic OS=Nicotiana sylvestris E-value=1e-24; |
| Length | 245 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_UV-B; |
| Sequence | GTCATTTTTTCTTTTATCAAAAGATGGAACGCTAAAAATAAGGAAAAGTAAATTAGTCTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |