Detail of EST/Unigene DY632686 |
Acc. | DY632686 |
Internal Acc. | Medicago--01-M08.g1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Cyanogenic beta-glucosidase (Fragment) OS=Trifolium repens E-value=2e-31; Non-cyanogenic beta-glucosidase OS=Trifolium repens E-value=4e-28; Beta-glucosidase 29 OS=Oryza sativa subsp. japonica E-value=4e-26; Beta-glucosidase 13 OS=Oryza sativa subsp. japonica E-value=3e-25; Beta-glucosidase 12 OS=Oryza sativa subsp. japonica E-value=6e-25; |
Length | 236 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_UV-B; |
Sequence | ATTCACTAGTGATTAGCGTGGTCGCGGCCGAGGTACAAGGAAGATATTGGAATCATGAAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K05350 beta-glucosidase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K05350 beta-glucosidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K05350 beta-glucosidase |
EC | 3.2.1.21 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817104 |
Trichome-related Gene from Literature | N/A |