Detail of EST/Unigene DY632788
Acc. DY632788
Internal Acc. Medicago--02-H12.g1
Type EST
Annotation (Top 5 hits in Uniprot_trembl) Ribulose bisphosphate carboxylase small chain, chloroplastic OS=Medicago sativa E-value=1e-10; Ribulose bisphosphate carboxylase small chain 3A, chloroplastic OS=Pisum sativum E-value=2e-10; Ribulose bisphosphate carboxylase small chain 3C, chloroplastic OS=Pisum sativum E-value=2e-10; Ribulose bisphosphate carboxylase small chain, chloroplastic OS=Hevea brasiliensis E-value=2e-09; Ribulose bisphosphate carboxylase small chain, chloroplastic (Fragment) OS=Pisum sativum E-value=3e-09;
Length 118 nt
Species Medicago truncatula
Belonged EST Libraries MT_UV-B;
Sequence TAGCGTGGTCGCGGCCGAGGTACACAAATCCTTTCTCGGTCTCGAATTCCAAGCAAGCAA
CCCATCCCTTCCTTATAAGGTATTCAACTTCTTTCGCCAATTGTTCTCTGGTCAATGG
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene 843029 
Trichome-related Gene from Literature 843029