| Detail of EST/Unigene DY632946 |
| Acc. | DY632946 |
| Internal Acc. | Medicago--01-D06.b1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Photosystem I reaction center subunit III, chloroplastic OS=Flaveria trinervia E-value=2e-50; Photosystem I reaction center subunit III, chloroplastic OS=Arabidopsis thaliana E-value=9e-49; Photosystem I reaction center subunit III, chloroplastic OS=Spinacia oleracea E-value=1e-46; Photosystem I reaction center subunit III, chloroplastic OS=Hordeum vulgare E-value=1e-45; Photosystem I reaction center subunit III OS=Guillardia theta E-value=2e-28; |
| Length | 447 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_UV-B; |
| Sequence | TTCGAGCGGCCGCCCGGGCAGGTCTCTCAACCAACATCATCCACTGCAGCACAAACCAAG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 840021 |
| Trichome-related Gene from Literature | N/A |