| Detail of EST/Unigene DY633081 |
| Acc. | DY633081 |
| Internal Acc. | Medicago--02-G20.b1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Fructan 6-exohydrolase OS=Beta vulgaris E-value=2e-31; Beta-fructofuranosidase, cell wall isozyme OS=Pisum sativum E-value=2e-30; Beta-fructofuranosidase, insoluble isoenzyme CWINV3 OS=Arabidopsis thaliana E-value=1e-28; Beta-fructofuranosidase, insoluble isoenzyme CWINV1 OS=Arabidopsis thaliana E-value=7e-28; Beta-fructofuranosidase, insoluble isoenzyme CWINV5 OS=Arabidopsis thaliana E-value=5e-24; |
| Length | 372 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_UV-B; |
| Sequence | TCGAGCGGCCGCCCGGGCAGGTACCAATAAAAGAACATTACGTCTATCATTTTTCTTTAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 841955 |
| Trichome-related Gene from Literature | N/A |