Detail of EST/Unigene DY633110 |
Acc. | DY633110 |
Internal Acc. | Medicago--03-G09.b1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 8, chloroplastic OS=Solanum lycopersicum E-value=2e-38; Chlorophyll a-b binding protein 3, chloroplastic OS=Pisum sativum E-value=1e-36; Chlorophyll a-b binding protein E, chloroplastic OS=Nicotiana plumbaginifolia E-value=3e-14; Chlorophyll a-b binding protein type 2 member 1B, chloroplastic OS=Pinus sylvestris E-value=3e-14; Chlorophyll a-b binding protein 7, chloroplastic OS=Nicotiana tabacum E-value=3e-14; |
Length | 416 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_UV-B; |
Sequence | TTCGAGCGGCCGCCCGGGCAGGACAATCCTGGCTCCTGGGACAAACAATACTTCTTAGGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 842446 |
Trichome-related Gene from Literature | N/A |