| Detail of EST/Unigene DY633143 |
| Acc. | DY633143 |
| Internal Acc. | Medicago--03-O08.b1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Aspartate aminotransferase OS=Thermus aquaticus E-value=2e-16; Aspartate aminotransferase OS=Thermus thermophilus (strain HB8 / ATCC 27634 / DSM 579) E-value=6e-16; Bifunctional aspartate aminotransferase and glutamate/aspartate-prephenate aminotransferase OS=Arabidopsis thaliana E-value=2e-15; Bifunctional aspartate aminotransferase and glutamate/aspartate-prephenate aminotransferase OS=Petunia hybrida E-value=1e-14; Aspartate aminotransferase OS=Aquifex aeolicus (strain VF5) E-value=2e-13; |
| Length | 489 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_UV-B; |
| Sequence | TAGCGTGGTCGCGGCCGAGGTACTCATATGTATTGTCCACAACAAGCCAAGAGCCAGCTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K00816 kynurenine-oxoglutarate transaminase; Metabolism > Amino Acid Metabolism > ko00300 Lysine biosynthesis > K00825 2-aminoadipate transaminase; Metabolism > Amino Acid Metabolism > ko00310 Lysine degradation > K00825 2-aminoadipate transaminase |
| EC | 2.6.1.- 2.6.1.39 2.6.1.7 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 844376 |
| Trichome-related Gene from Literature | N/A |