Detail of EST/Unigene DY633179 |
Acc. | DY633179 |
Internal Acc. | Medicago--03-G24.b1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-61; Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=2e-61; Chlorophyll a-b binding protein type 2 member 1B, chloroplastic OS=Pinus sylvestris E-value=2e-61; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=2e-61; Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=3e-61; |
Length | 531 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_UV-B; |
Sequence | TTTTAGCGGCCGCCCGGGCAGGTACAAACTTAGGGAGAAGAAAAAAAGATGTAATGCGCC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839871 |
Trichome-related Gene from Literature | 839871 |