Detail of EST/Unigene DY633265
Acc. DY633265
Internal Acc. Medicago--03-A15.g1
Type EST
Annotation (Top 5 hits in Uniprot_trembl) Ribulose bisphosphate carboxylase small chain, chloroplastic OS=Medicago sativa E-value=1e-12; Ribulose bisphosphate carboxylase small chain 3A, chloroplastic OS=Pisum sativum E-value=7e-12; Ribulose bisphosphate carboxylase small chain 3C, chloroplastic OS=Pisum sativum E-value=7e-12; Ribulose bisphosphate carboxylase small chain, chloroplastic OS=Trifolium repens E-value=2e-11; Ribulose bisphosphate carboxylase small chain, chloroplastic (Fragment) OS=Pisum sativum E-value=6e-11;
Length 107 nt
Species Medicago truncatula
Belonged EST Libraries MT_UV-B;
Sequence AGGTGCAATGGTGGAAGAGTGAACTGTATGCAGGTTTGGCCACCAATTGGCAAGAAGAAG
TTTGAAACACTTCCATACCTTCCACCCCTTACTGAGGATCAATTGGC
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene 843029 
Trichome-related Gene from Literature 843029