Detail of EST/Unigene DY633278 |
Acc. | DY633278 |
Internal Acc. | Medicago--03-E14.g1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein type 2 member 1B, chloroplastic OS=Pinus sylvestris E-value=3e-09; Chlorophyll a-b binding protein 1A, chloroplastic OS=Pyrus pyrifolia E-value=3e-09; Chlorophyll a-b binding protein type 2 member 1A, chloroplastic OS=Pinus sylvestris E-value=3e-09; Chlorophyll a-b binding protein M9, chloroplastic OS=Zea mays E-value=6e-09; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=6e-09; |
Length | 248 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_UV-B; |
Sequence | GCGGCCGCCCGGGCAGGTACAAACTTAAGAAGAAGAAAAAAAGATGTAATGCGCCATACG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839871 |
Trichome-related Gene from Literature | 839871 |