Detail of EST/Unigene DY633343 |
Acc. | DY633343 |
Internal Acc. | Medicago--03-H16.b1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Cyanogenic beta-glucosidase (Fragment) OS=Trifolium repens E-value=6e-78; Beta-glucosidase 12 OS=Oryza sativa subsp. japonica E-value=2e-61; Beta-glucosidase 10 OS=Oryza sativa subsp. japonica E-value=1e-58; Putative beta-glucosidase 9 OS=Oryza sativa subsp. japonica E-value=1e-58; Isoflavonoid 7-O-beta-apiosyl-glucoside beta-glycosidase OS=Dalbergia nigrescens E-value=6e-58; |
Length | 509 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_UV-B; |
Sequence | TAGCGTGGTCGCGGCCGAGGTACAAGGAAGATATTGGAATCATGAAGGATTTGAATATGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K05350 beta-glucosidase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K05350 beta-glucosidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K05350 beta-glucosidase |
EC | 3.2.1.21 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 834231 |
Trichome-related Gene from Literature | N/A |