Detail of EST/Unigene EB426120 |
Acc. | EB426120 |
Internal Acc. | KF8C.105D24F.051215T7 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase OS=Nicotiana tabacum E-value=3e-50; Glucan endo-1,3-beta-glucosidase OS=Nicotiana tabacum E-value=5e-47; Glucan endo-1,3-beta-glucosidase, acidic isoform GL153 OS=Nicotiana tabacum E-value=5e-38; Glucan endo-1,3-beta-glucosidase, acidic isoform GL161 OS=Nicotiana tabacum E-value=1e-35; Glucan endo-1,3-beta-glucosidase, acidic isoform GI9 OS=Nicotiana tabacum E-value=1e-32; |
Length | 442 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_KF8; |
Sequence | ATTATCTTTCCAACTGAACTTAAGATTGACCTAACTGCCTCGTTCTTGAAACTGCACTCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824893 |
Trichome-related Gene from Literature | 824893 |