Detail of EST/Unigene EB427006 |
Acc. | EB427006 |
Internal Acc. | KF8C.108M05F.051215T7 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Nicotiana tabacum E-value=0; Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Arabidopsis thaliana E-value=0; Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Brassica napus E-value=0; Omega-3 fatty acid desaturase, chloroplastic OS=Ricinus communis E-value=0; Omega-3 fatty acid desaturase, chloroplastic OS=Sesamum indicum E-value=0; |
Length | 768 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_KF8; |
Sequence | GGCAGCTTTTCAGACAGCCAGTTGCTAAATAATGTGGTTGGTCACATACTTCATCCTGCC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817548 |
Trichome-related Gene from Literature | N/A |