| Detail of EST/Unigene EB427006 |
| Acc. | EB427006 |
| Internal Acc. | KF8C.108M05F.051215T7 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Nicotiana tabacum E-value=0; Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Arabidopsis thaliana E-value=0; Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Brassica napus E-value=0; Omega-3 fatty acid desaturase, chloroplastic OS=Ricinus communis E-value=0; Omega-3 fatty acid desaturase, chloroplastic OS=Sesamum indicum E-value=0; |
| Length | 768 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | NT_KF8; |
| Sequence | GGCAGCTTTTCAGACAGCCAGTTGCTAAATAATGTGGTTGGTCACATACTTCATCCTGCC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 817548 |
| Trichome-related Gene from Literature | N/A |