Detail of EST/Unigene EB428204 |
Acc. | EB428204 |
Internal Acc. | KF8B.200I16F.060128T7 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase OS=Nicotiana tabacum E-value=1e-31; Glucan endo-1,3-beta-glucosidase OS=Nicotiana tabacum E-value=5e-29; Glucan endo-1,3-beta-glucosidase, acidic isoform GL153 OS=Nicotiana tabacum E-value=4e-27; Glucan endo-1,3-beta-glucosidase, acidic isoform GL161 OS=Nicotiana tabacum E-value=4e-25; Glucan endo-1,3-beta-glucosidase A OS=Solanum lycopersicum E-value=1e-23; |
Length | 525 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_KF8; |
Sequence | GTACAGTTCTAGCCCATGGTTAACCTCTTAACATGTGTTACTAACCGAAAGGGAGGGAGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824893 |
Trichome-related Gene from Literature | 824893 |