Detail of EST/Unigene EB428900 |
Acc. | EB428900 |
Internal Acc. | KF8B.202K10F.060124T7 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Flavonoid 3'-monooxygenase OS=Petunia hybrida E-value=0; Flavonoid 3'-monooxygenase OS=Arabidopsis thaliana E-value=1e-86; Flavonoid 3',5'-hydroxylase OS=Eustoma exaltatum subsp. russellianum E-value=9e-54; Flavonoid 3',5'-hydroxylase OS=Eustoma exaltatum subsp. russellianum E-value=9e-54; Flavonoid 3',5'-hydroxylase 1 OS=Petunia hybrida E-value=6e-52; |
Length | 832 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_KF8; |
Sequence | AATCTTTTCCCTACTTCTCTACACTGTCATTTTCTCTTTCCTTCTACATTCCATTCTCAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07410 cytochrome P450, family 1, subfamily B, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07410 cytochrome P450, family 1, subfamily B, polypeptide 1; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07414 cytochrome P450, family 2, subfamily D |
EC | 1.14.14.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 830693 |
Trichome-related Gene from Literature | 830693 |