| Detail of EST/Unigene EB430258 |
| Acc. | EB430258 |
| Internal Acc. | KL5B.106F04F.060224T7 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Cysteine synthase OS=Solanum tuberosum E-value=5e-26; Cysteine synthase OS=Citrullus lanatus E-value=2e-22; Cysteine synthase OS=Triticum aestivum E-value=4e-21; Cysteine synthase OS=Oryza sativa subsp. japonica E-value=4e-21; Cysteine synthase OS=Spinacia oleracea E-value=6e-21; |
| Length | 738 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | NT_KL5B; |
| Sequence | AGGTATGAGGGAATTAAAAATTGAATTTCTTTTTAAATATGGGCAGAAAAGTGATTCTGA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00260 Glycine, serine and threonine metabolism > K01697 cystathionine beta-synthase; Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K01697 cystathionine beta-synthase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K01697 cystathionine beta-synthase |
| EC | 4.2.1.22 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827145 |
| Trichome-related Gene from Literature | 827145 |