Detail of EST/Unigene EB434011 |
Acc. | EB434011 |
Internal Acc. | TL13.105N07F.060313T7 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein type 2 member 1B, chloroplastic OS=Pinus sylvestris E-value=1e-08; Chlorophyll a-b binding protein 1A, chloroplastic OS=Pyrus pyrifolia E-value=1e-08; Chlorophyll a-b binding protein type 2 member 1A, chloroplastic OS=Pinus sylvestris E-value=1e-08; Chlorophyll a-b binding protein M9, chloroplastic OS=Zea mays E-value=1e-08; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=1e-08; |
Length | 170 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_TL13; |
Sequence | AACCTTGCTGACCATCTTGCAGACCCAGTTAACAACAATGCTTGGGCATACGCCACAAAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818005 |
Trichome-related Gene from Literature | N/A |