Detail of EST/Unigene EB434505 |
Acc. | EB434505 |
Internal Acc. | TL13.107F12F.060315T7 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Omega-6 fatty acid desaturase, endoplasmic reticulum OS=Brassica juncea E-value=8e-49; Omega-6 fatty acid desaturase, endoplasmic reticulum isozyme 2 OS=Glycine max E-value=4e-48; Omega-6 fatty acid desaturase, endoplasmic reticulum OS=Arabidopsis thaliana E-value=7e-48; Omega-6 fatty acid desaturase, endoplasmic reticulum isozyme 1 OS=Glycine max E-value=7e-46; Delta(12) fatty acid dehydrogenase OS=Crepis alpina E-value=1e-34; |
Length | 444 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_TL13; |
Sequence | TTCATCCGAATGGGATTGGCTAAGGGGAGCTTTGGCAACAGTCGACAGAGACTATGGCAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820387 |
Trichome-related Gene from Literature | 820387 |