| Detail of EST/Unigene EB435947 |
| Acc. | EB435947 |
| Internal Acc. | TL13.002N22F.060117T7 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Ribulose bisphosphate carboxylase/oxygenase activase 1, chloroplastic OS=Nicotiana tabacum E-value=4e-10; Ribulose bisphosphate carboxylase/oxygenase activase, chloroplastic OS=Malus domestica E-value=2e-06; Ribulose bisphosphate carboxylase/oxygenase activase 2, chloroplastic OS=Nicotiana tabacum E-value=3e-06; Ribulose bisphosphate carboxylase/oxygenase activase, chloroplastic OS=Vigna radiata var. radiata E-value=3e-06; |
| Length | 403 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | NT_TL13; |
| Sequence | AAGAGAGTTCAGTTGGCTGACAAATACCTCAAAGAGGCTGCACTTGGTGATGCCAATGCT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 818558 |
| Trichome-related Gene from Literature | 818558 |