Detail of EST/Unigene EB435947 |
Acc. | EB435947 |
Internal Acc. | TL13.002N22F.060117T7 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ribulose bisphosphate carboxylase/oxygenase activase 1, chloroplastic OS=Nicotiana tabacum E-value=4e-10; Ribulose bisphosphate carboxylase/oxygenase activase, chloroplastic OS=Malus domestica E-value=2e-06; Ribulose bisphosphate carboxylase/oxygenase activase 2, chloroplastic OS=Nicotiana tabacum E-value=3e-06; Ribulose bisphosphate carboxylase/oxygenase activase, chloroplastic OS=Vigna radiata var. radiata E-value=3e-06; |
Length | 403 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_TL13; |
Sequence | AAGAGAGTTCAGTTGGCTGACAAATACCTCAAAGAGGCTGCACTTGGTGATGCCAATGCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818558 |
Trichome-related Gene from Literature | 818558 |