Detail of EST/Unigene EB436821 |
Acc. | EB436821 |
Internal Acc. | BL12.102I18F.060309T7 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 16, chloroplastic OS=Nicotiana tabacum E-value=2e-79; Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=3e-79; Chlorophyll a-b binding protein 91R, chloroplastic OS=Petunia sp. E-value=4e-79; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=4e-79; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=7e-79; |
Length | 520 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NB_BL12; |
Sequence | TGTCAAGTTTGGTGAGGCTGTGTGGTTCAAGGCTGGATCCCAAATCTTTAGCGAGGGTGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818005 |
Trichome-related Gene from Literature | N/A |