Detail of EST/Unigene EB441680 |
Acc. | EB441680 |
Internal Acc. | KN6B.109N24F.060106T7 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-50; Chlorophyll a-b binding protein 91R, chloroplastic OS=Petunia sp. E-value=2e-50; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=3e-50; Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=3e-50; Chlorophyll a-b binding protein 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=3e-50; |
Length | 393 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_KN6B; |
Sequence | GAGCCGTCGAGGGTTACCGTGTTGCTGGTGGGCCTCTTGGTGAGGTTGTTGACCCACTTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818005 |
Trichome-related Gene from Literature | N/A |