| Detail of EST/Unigene EB679976 |
| Acc. | EB679976 |
| Internal Acc. | KL4B.102M07F.051125T7 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Superoxide dismutase [Fe], chloroplastic (Fragment) OS=Nicotiana plumbaginifolia E-value=2e-25; Superoxide dismutase [Fe], chloroplastic OS=Arabidopsis thaliana E-value=8e-14; Superoxide dismutase [Fe], chloroplastic OS=Glycine max E-value=9e-12; Superoxide dismutase [Fe] OS=Synechocystis sp. (strain PCC 6803 / Kazusa) E-value=2e-11; Superoxide dismutase [Mn] OS=Rhizobium meliloti (strain 1021) E-value=5e-11; |
| Length | 164 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | NT_KL4B; |
| Sequence | GGTTCCTATGATGCATTTGTTAAAGAATTTAAGGCAGCTGCGGCAACACAATTTGGCTCC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 828613 |
| Trichome-related Gene from Literature | 828613 |