Detail of EST/Unigene EB680297 |
Acc. | EB680297 |
Internal Acc. | KL4B.106L22F.051125T7 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein M9, chloroplastic OS=Zea mays E-value=5e-24; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=5e-24; Chlorophyll a-b binding protein C, chloroplastic OS=Nicotiana plumbaginifolia E-value=5e-24; Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=5e-24; Chlorophyll a-b binding protein 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=5e-24; |
Length | 182 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_KL4B; |
Sequence | AAGAACGGAAGACTCGCCATGTTCTCTATGTTCGGATTCTTTGTTCAAGCCATTGTTACC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818005 |
Trichome-related Gene from Literature | N/A |