Detail of EST/Unigene EB683431 |
Acc. | EB683431 |
Internal Acc. | KR3B.112I20F.060119T7 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ribosomal protein S14, mitochondrial OS=Oenothera berteriana E-value=9e-39; Ribosomal protein S14, mitochondrial OS=Vicia faba E-value=7e-37; Ribosomal protein S14, mitochondrial OS=Brassica napus E-value=2e-36; Ribosomal protein S14, mitochondrial OS=Marchantia polymorpha E-value=5e-29; 30S ribosomal protein S14 OS=Maricaulis maris (strain MCS10) E-value=8e-20; |
Length | 676 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_KR3B; |
Sequence | CAGCAAATCGACTGGATTCGAACGAGCAAAAATGAACTCAATGGTGGCTTTAGGGAAGAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818015 |
Trichome-related Gene from Literature | 818015 |