Detail of EST/Unigene EF601089 |
Acc. | EF601089 |
Internal Acc. | |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Phytoene dehydrogenase, chloroplastic/chromoplastic OS=Glycine max E-value=3e-38; Phytoene dehydrogenase, chloroplastic/chromoplastic OS=Solanum lycopersicum E-value=2e-35; 15-cis-phytoene desaturase, chloroplastic/chromoplastic OS=Capsicum annuum E-value=3e-34; 15-cis-phytoene desaturase, chloroplastic/chromoplastic OS=Arabidopsis thaliana E-value=5e-34; Phytoene dehydrogenase, chloroplastic/chromoplastic OS=Zea mays E-value=8e-33; |
Length | 519 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_CDS; |
Sequence | TACCACGTTGTTAAAACACCAAGGTCGGTTTACAAAACTGTTCCAAATTGTGAACCATGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827061 |
Trichome-related Gene from Literature | 827061 |