Detail of EST/Unigene EG553599 |
Acc. | EG553599 |
Internal Acc. | to00714 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase B OS=Solanum lycopersicum E-value=1e-57; Glucan endo-1,3-beta-glucosidase, basic isoform 2 OS=Solanum tuberosum E-value=4e-52; Glucan endo-1,3-beta-glucosidase, basic isoform 1 (Fragment) OS=Solanum tuberosum E-value=4e-52; Glucan endo-1,3-beta-glucosidase, basic isoform 3 (Fragment) OS=Solanum tuberosum E-value=1e-51; Glucan endo-1,3-beta-glucosidase, basic vacuolar isoform GLB OS=Nicotiana tabacum E-value=4e-47; |
Length | 535 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_DROOT; |
Sequence | AACTTATTTGATGCTATGTTGGATTCTGTTTGTGCTGCGATGGATCGAACAGGAGGAGGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824893 |
Trichome-related Gene from Literature | 824893 |