Detail of EST/Unigene EH369882 |
Acc. | EH369882 |
Internal Acc. | B02_j001_plate_91 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Cysteine synthase, chloroplastic/chromoplastic OS=Solanum tuberosum E-value=6e-45; Cysteine synthase, chloroplastic/chromoplastic OS=Capsicum annuum E-value=4e-44; Cysteine synthase, chloroplastic/chromoplastic OS=Spinacia oleracea E-value=5e-24; Cysteine synthase, chloroplastic/chromoplastic OS=Arabidopsis thaliana E-value=8e-24; Cysteine synthase, mitochondrial OS=Arabidopsis thaliana E-value=3e-22; |
Length | 368 nt |
Species | Nicotiana benthamiana |
Belonged EST Libraries | NB_GTISSUE; |
Sequence | GATAGCTTTTAGCAATAGCAATGGCGACTTTCATCAACAATCCCTTGACTTCACTCTGTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818978 |
Trichome-related Gene from Literature | 818978 |