Detail of EST/Unigene EH613763 |
Acc. | EH613763 |
Internal Acc. | EST_CSP002xa08f1.ab1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Sulfite reductase 1 [ferredoxin], chloroplastic OS=Nicotiana tabacum E-value=4e-50; Sulfite reductase [ferredoxin], chloroplastic OS=Pisum sativum E-value=2e-35; Sulfite reductase [ferredoxin], chloroplastic OS=Arabidopsis thaliana E-value=3e-10; Sulfite reductase [ferredoxin], chloroplastic OS=Zea mays E-value=1e-08; |
Length | 536 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_EST_CSP; |
Sequence | GATCTTGAAAAGTTCTGGAGCCTTTATTTTTCCATTGGAGAAGAAAGCGACAATCTAAAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 830336 |
Trichome-related Gene from Literature | 830336 |