Detail of EST/Unigene EH614969 |
Acc. | EH614969 |
Internal Acc. | EST_CSP015xc08f1.ab1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=1e-69; Chlorophyll a-b binding protein 16, chloroplastic OS=Nicotiana tabacum E-value=1e-69; Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=1e-69; Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=1e-69; Chlorophyll a-b binding protein 91R, chloroplastic OS=Petunia sp. E-value=2e-69; |
Length | 405 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_EST_CSP; |
Sequence | GGAGGTGTTCCACTGCAGATGGGCCATGCTTGGAGCTCTTGGTTGTGTCTTCCCCGAGCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 822391 |
Trichome-related Gene from Literature | N/A |