Detail of EST/Unigene EH615957 |
Acc. | EH615957 |
Internal Acc. | EST_FLW004xb04f1.ab1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=8e-51; Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=2e-46; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=8e-45; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=2e-44; Chlorophyll a-b binding protein C, chloroplastic OS=Nicotiana plumbaginifolia E-value=3e-44; |
Length | 354 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_EST_FLW; |
Sequence | CGCGGGGACACAGCCACTTGGGCATTTCAACCATCAAACACTCACTTTTCTTTTCAAAAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839871 |
Trichome-related Gene from Literature | 839871 |