| Detail of EST/Unigene EH618695 |
| Acc. | EH618695 |
| Internal Acc. | CHO_SL015xm17f2.ab1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Farnesyl pyrophosphate synthase OS=Helianthus annuus E-value=0; Farnesyl pyrophosphate synthase OS=Artemisia annua E-value=0; Farnesyl pyrophosphate synthase 2 OS=Lupinus albus E-value=0; Farnesyl pyrophosphate synthase 2 OS=Parthenium argentatum E-value=0; Farnesyl diphosphate synthase 1 OS=Artemisia spiciformis E-value=0; |
| Length | 714 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | NT_CHO_SL; |
| Sequence | AAATCCAAGTTTTTGGAGGTTTACTCAGAAATAAAATCTGAGCTTCTTAATGATCCTGAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00900 Terpenoid biosynthesis > K00787 dimethylallyltranstransferase; Metabolism > Lipid Metabolism > ko00100 Biosynthesis of steroids > K00787 dimethylallyltranstransferase; Metabolism > Biosynthesis of Secondary Metabolites > ko00900 Terpenoid biosynthesis > K00795 geranyltranstransferase; Metabolism > Lipid Metabolism > ko00100 Biosynthesis of steroids > K00795 geranyltranstransferase |
| EC | 2.5.1.1 2.5.1.10 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 834828 |
| Trichome-related Gene from Literature | N/A |