Detail of EST/Unigene EH624124 |
Acc. | EH624124 |
Internal Acc. | CHO_SL003xc13f1.ab1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Sulfite reductase 1 [ferredoxin], chloroplastic OS=Nicotiana tabacum E-value=4e-60; Sulfite reductase [ferredoxin], chloroplastic OS=Pisum sativum E-value=5e-43; Sulfite reductase [ferredoxin], chloroplastic OS=Arabidopsis thaliana E-value=2e-16; Sulfite reductase [ferredoxin], chloroplastic OS=Zea mays E-value=1e-14; Sulfite reductase [ferredoxin] OS=Synechococcus elongatus (strain PCC 7942) E-value=4e-09; |
Length | 673 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_CHO_SL; |
Sequence | TGGACTCCCATCAAACTTCATTGGCAAAAACTTTCAAGGATAAGCTTAAGGTTCAGGATC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 830336 |
Trichome-related Gene from Literature | 830336 |