Detail of EST/Unigene EL610435 |
Acc. | EL610435 |
Internal Acc. | mfcorjr2a12 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Putative quinone-oxidoreductase homolog, chloroplastic OS=Arabidopsis thaliana E-value=1e-99; Quinone-oxidoreductase homolog, chloroplastic OS=Spinacia oleracea E-value=3e-99; Reticulon-4-interacting protein 1, mitochondrial OS=Bos taurus E-value=9e-28; Reticulon-4-interacting protein 1, mitochondrial OS=Homo sapiens E-value=1e-27; Reticulon-4-interacting protein 1 homolog, mitochondrial OS=Danio rerio E-value=7e-27; |
Length | 729 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_FAL_SSH; |
Sequence | CAAACGCTTCTTCGAAAAAGTAAGTTTCTTCAGTACAAAAGTCAACATTGAACTTGGACC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 1.6.5.5 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 826914 |
Trichome-related Gene from Literature | N/A |