Detail of EST/Unigene EL610488 |
Acc. | EL610488 |
Internal Acc. | mfcorjr2f6 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein P4, chloroplastic OS=Pisum sativum E-value=6e-35; Chlorophyll a-b binding protein 4, chloroplastic OS=Arabidopsis thaliana E-value=1e-32; Chlorophyll a-b binding protein 1B-20, chloroplastic (Fragment) OS=Hordeum vulgare Ib-20 E-value=3e-28; Chlorophyll a-b binding protein 1B-21, chloroplastic OS=Hordeum vulgare Ib-21 E-value=6e-14; Chlorophyll a-b binding protein 8, chloroplastic OS=Solanum lycopersicum E-value=3e-13; |
Length | 335 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_FAL_SSH; |
Sequence | ACATAGAAATAGAATAAGGATCATAACAATCATGCCCGGATGTCTTTCAAAATTCATCCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 823901 |
Trichome-related Gene from Literature | N/A |