Detail of EST/Unigene EL610495 |
Acc. | EL610495 |
Internal Acc. | mfcorjr2g2 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Oxygen-evolving enhancer protein 1, chloroplastic OS=Pisum sativum E-value=5e-68; Oxygen-evolving enhancer protein 1, chloroplastic OS=Nicotiana tabacum E-value=4e-64; Oxygen-evolving enhancer protein 1, chloroplastic OS=Solanum tuberosum E-value=5e-63; Oxygen-evolving enhancer protein 1, chloroplastic OS=Spinacia oleracea E-value=8e-63; Oxygen-evolving enhancer protein 1, chloroplastic OS=Solanum lycopersicum E-value=2e-62; |
Length | 447 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_FAL_SSH; |
Sequence | ACCATCATACAGAGGAAGCTCTTTCTTGGACCCAAAGGGAAGAGGTGCATCTACCGGTTA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824246 |
Trichome-related Gene from Literature | N/A |