Detail of EST/Unigene EL610498 |
Acc. | EL610498 |
Internal Acc. | mfcorjr2g6 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Oxygen-evolving enhancer protein 2, chloroplastic OS=Pisum sativum E-value=7e-58; Oxygen-evolving enhancer protein 2, chloroplastic OS=Spinacia oleracea E-value=2e-49; Oxygen-evolving enhancer protein 2, chloroplastic OS=Solanum tuberosum E-value=2e-46; Oxygen-evolving enhancer protein 2, chloroplastic OS=Triticum aestivum E-value=3e-46; Oxygen-evolving enhancer protein 2, chloroplastic OS=Fritillaria agrestis E-value=4e-46; |
Length | 373 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_FAL_SSH; |
Sequence | GCTGGTGGAGATGAAGGTGGAAAGCACCAGCTGATTACAGCAGTCCTTGTCAAAACTGAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 837178 |
Trichome-related Gene from Literature | N/A |