| Detail of EST/Unigene EL610501 |
| Acc. | EL610501 |
| Internal Acc. | mfcorjr2g10 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Oxygen-evolving enhancer protein 2, chloroplastic OS=Pisum sativum E-value=7e-58; Oxygen-evolving enhancer protein 2, chloroplastic OS=Spinacia oleracea E-value=2e-49; Oxygen-evolving enhancer protein 2, chloroplastic OS=Solanum tuberosum E-value=2e-46; Oxygen-evolving enhancer protein 2, chloroplastic OS=Triticum aestivum E-value=3e-46; Oxygen-evolving enhancer protein 2, chloroplastic OS=Fritillaria agrestis E-value=4e-46; |
| Length | 373 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_FAL_SSH; |
| Sequence | GCTGGTGGAGATGAAGGTGGAAAGCACCAGCTGATTACAGCAGTCCTTGTCAAAACTGAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 837178 |
| Trichome-related Gene from Literature | N/A |