Detail of EST/Unigene ES892096 |
Acc. | ES892096 |
Internal Acc. | LET042F8_2005-10-05_1/LET042F8_D03_1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 1C, chloroplastic (Fragments) OS=Solanum lycopersicum E-value=1e-13; Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=1e-13; Chlorophyll a-b binding protein 1A, chloroplastic (Fragments) OS=Solanum lycopersicum E-value=3e-12; Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=1e-11; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=1e-10; |
Length | 151 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_TRI; |
Sequence | GGGCAACTCCCTCATTTTCCTCTCTTTAAAAACCATGGCAGCTGCTACAATGGCTCTTTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839871 |
Trichome-related Gene from Literature | 839871 |