| Detail of EST/Unigene EU220212 |
| Acc. | EU220212 |
| Internal Acc. | |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | NAD(P)H-quinone oxidoreductase subunit 4L, chloroplastic OS=Cicer arietinum E-value=5e-15; NAD(P)H-quinone oxidoreductase subunit 4L, chloroplastic OS=Lotus japonicus E-value=1e-14; NAD(P)H-quinone oxidoreductase subunit 4L, chloroplastic OS=Vitis vinifera E-value=2e-14; NAD(P)H-quinone oxidoreductase subunit 4L, chloroplastic OS=Nicotiana tabacum E-value=2e-14; NAD(P)H-quinone oxidoreductase subunit 4L, chloroplastic OS=Solanum tuberosum E-value=2e-14; |
| Length | 120 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_CDS; |
| Sequence | GATTATCAAAAAAATCAGAAAAAGTTACAAGATTTATATTAACTGCATTCAGTATAAGTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |