| Detail of EST/Unigene EU292216 |
| Acc. | EU292216 |
| Internal Acc. | |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Acetolactate synthase 2, chloroplastic OS=Nicotiana tabacum SURB E-value=0; Acetolactate synthase 1, chloroplastic OS=Nicotiana tabacum SURA E-value=0; Acetolactate synthase, chloroplastic OS=Arabidopsis thaliana 1.2 E-value=0; Acetolactate synthase 3, chloroplastic OS=Brassica napus E-value=0; Acetolactate synthase 1, chloroplastic OS=Brassica napus E-value=0; |
| Length | 2052 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_CDS; |
| Sequence | CAAGACAAGACAACGACCCTGATTCACAGTTGCAAACTCTCACACTCTGCCTTCACTTCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 4.1.-.- |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 824015 |
| Trichome-related Gene from Literature | N/A |