Detail of EST/Unigene EW700715 |
Acc. | EW700715 |
Internal Acc. | EST00455 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 3, chloroplastic OS=Glycine max E-value=0; Chlorophyll a-b binding protein of LHCII type I, chloroplastic (Fragment) OS=Cucumis sativus E-value=0; Chlorophyll a-b binding protein, chloroplastic (Fragment) OS=Glycine max E-value=0; Chlorophyll a-b binding protein 1, chloroplastic OS=Zea mays E-value=1e-97; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=4e-97; |
Length | 710 nt |
Species | Cannabis sativa |
Belonged EST Libraries | LIBEST_019973; |
Sequence | AAAACACATTTGGTGAAACTCTTAAATTTTTTTCCTCTCTTTTTCAAATTCTCAACCAAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818005 |
Trichome-related Gene from Literature | N/A |